normalized whole transcriptome microarray expression data Search Results


94
ATCC human mammary epithelial cells
Figure 1. HOXB7 mRNA levels in normal breast, primary breast carcinomas, and distant metastases. A, relative expression levels of HOXB7 mRNA in purified <t>epithelial</t> cells from human mammary epithelial cells (Normal), lymph node–positive invasive ductal carcinoma (IDC), and bone metastasis by microarray analysis. B, RT-PCR analysis of HOXB7 in normal human mammary epithelial cells (HMECs) and breast cancer cell lines. 36B4, a ribosomal protein mRNA that served as an internal loading control. C, the relative levels of HOXB7 mRNA as measured by quantitative real-time RT-PCR in nine purified mammary epithelial organoids from normal reduction mammoplasty samples, 31 primary breast carcinomas, and 19 breast metastasis to various organs. The two-tailed Student t test was applied for statistical analysis.
Human Mammary Epithelial Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human mammary epithelial cells/product/ATCC
Average 94 stars, based on 1 article reviews
human mammary epithelial cells - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

95
ATCC human coronary artery endothelial cells hcaecs
β-adrenergic receptor expression on infantile hemangioma (IH) and normal <t>endothelial</t> cells. RT-PCR expression assays measuring the steady state levels of ADRB1, ADRB2, and ADRB3 mRNA in primary cultures of human infantile hemangioma endothelial cells (HemECs), human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells <t>(HCAECs).</t> Expression data are represented as the relative abundance of each transcript normalized to the GAPDH levels.
Human Coronary Artery Endothelial Cells Hcaecs, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human coronary artery endothelial cells hcaecs/product/ATCC
Average 95 stars, based on 1 article reviews
human coronary artery endothelial cells hcaecs - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

90
OmicSoft Corporation array studio software
β-adrenergic receptor expression on infantile hemangioma (IH) and normal <t>endothelial</t> cells. RT-PCR expression assays measuring the steady state levels of ADRB1, ADRB2, and ADRB3 mRNA in primary cultures of human infantile hemangioma endothelial cells (HemECs), human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells <t>(HCAECs).</t> Expression data are represented as the relative abundance of each transcript normalized to the GAPDH levels.
Array Studio Software, supplied by OmicSoft Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/array studio software/product/OmicSoft Corporation
Average 90 stars, based on 1 article reviews
array studio software - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Incyte corporation unigem high-density microarray
Summary of gene expression profiling studies involving human COPD/emphysema samples
Unigem High Density Microarray, supplied by Incyte corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/unigem high-density microarray/product/Incyte corporation
Average 90 stars, based on 1 article reviews
unigem high-density microarray - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
imaGenes GmbH dna-microarray based transcriptome data
Summary of gene expression profiling studies involving human COPD/emphysema samples
Dna Microarray Based Transcriptome Data, supplied by imaGenes GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna-microarray based transcriptome data/product/imaGenes GmbH
Average 90 stars, based on 1 article reviews
dna-microarray based transcriptome data - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Microarrays Inc microarray codelink human whole genome
Summary of gene expression profiling studies involving human COPD/emphysema samples
Microarray Codelink Human Whole Genome, supplied by Microarrays Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/microarray codelink human whole genome/product/Microarrays Inc
Average 90 stars, based on 1 article reviews
microarray codelink human whole genome - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology goat anti mouse sparc
Real-time RT-PCR amplification conditions for each primer pair
Goat Anti Mouse Sparc, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goat anti mouse sparc/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
goat anti mouse sparc - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
23andMe healthy screening panel
Real-time RT-PCR amplification conditions for each primer pair
Healthy Screening Panel, supplied by 23andMe, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/healthy screening panel/product/23andMe
Average 90 stars, based on 1 article reviews
healthy screening panel - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
Jackson Immuno donkey anti mouse cy3
mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was <t>Cy3-labeled</t> cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.
Donkey Anti Mouse Cy3, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/donkey anti mouse cy3/product/Jackson Immuno
Average 96 stars, based on 1 article reviews
donkey anti mouse cy3 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
DNA Chip Research Inc whole-exome sequencing
mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was <t>Cy3-labeled</t> cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.
Whole Exome Sequencing, supplied by DNA Chip Research Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/whole-exome sequencing/product/DNA Chip Research Inc
Average 90 stars, based on 1 article reviews
whole-exome sequencing - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

99
Thermo Fisher dna probes
mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was <t>Cy3-labeled</t> cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.
Dna Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna probes/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
dna probes - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp ubc hs00824723 m1
Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details
Gene Exp Ubc Hs00824723 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ubc hs00824723 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp ubc hs00824723 m1 - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

Image Search Results


Figure 1. HOXB7 mRNA levels in normal breast, primary breast carcinomas, and distant metastases. A, relative expression levels of HOXB7 mRNA in purified epithelial cells from human mammary epithelial cells (Normal), lymph node–positive invasive ductal carcinoma (IDC), and bone metastasis by microarray analysis. B, RT-PCR analysis of HOXB7 in normal human mammary epithelial cells (HMECs) and breast cancer cell lines. 36B4, a ribosomal protein mRNA that served as an internal loading control. C, the relative levels of HOXB7 mRNA as measured by quantitative real-time RT-PCR in nine purified mammary epithelial organoids from normal reduction mammoplasty samples, 31 primary breast carcinomas, and 19 breast metastasis to various organs. The two-tailed Student t test was applied for statistical analysis.

Journal: Cancer Research

Article Title: HOXB7, a Homeodomain Protein, Is Overexpressed in Breast Cancer and Confers Epithelial-Mesenchymal Transition

doi: 10.1158/0008-5472.can-05-4470

Figure Lengend Snippet: Figure 1. HOXB7 mRNA levels in normal breast, primary breast carcinomas, and distant metastases. A, relative expression levels of HOXB7 mRNA in purified epithelial cells from human mammary epithelial cells (Normal), lymph node–positive invasive ductal carcinoma (IDC), and bone metastasis by microarray analysis. B, RT-PCR analysis of HOXB7 in normal human mammary epithelial cells (HMECs) and breast cancer cell lines. 36B4, a ribosomal protein mRNA that served as an internal loading control. C, the relative levels of HOXB7 mRNA as measured by quantitative real-time RT-PCR in nine purified mammary epithelial organoids from normal reduction mammoplasty samples, 31 primary breast carcinomas, and 19 breast metastasis to various organs. The two-tailed Student t test was applied for statistical analysis.

Article Snippet: Immortalized cell lines derived from normal human mammary epithelial cells, MCF10A, normal Madin-Darby canine kidney (MDCK) breast cancer cell lines (American Type Culture Collection, Manassas, VA), normal organoid, and tumor RNA were extracted by Trizol method, and all cDNAs were prepared with 1 Ag of RNA in SuperScript II (Invitrogen, Carlsbad, CA) reactions according to the instructions of the manufacturer.

Techniques: Expressing, Purification, Microarray, Reverse Transcription Polymerase Chain Reaction, Control, Quantitative RT-PCR, Two Tailed Test

Figure 3. Cells with high expression of HOXB7 express mesenchymal markers and show loss of epithelial markers. A, Western blot analysis of E-cadherin, claudin 1 (CLD1), claudin 4 (CLD4), claudin 7 (CLD7), a-smooth muscle actin (a-SMA), and vimentin in MCF10A-vec, pooled clones of MCF10A-FB7 (MCF10A-FB7), and three separate clones (10A-FB7-C2, 10A-FB7-C5, and 10A-FB7-C10), MDCK-vec and pooled clones of MDCK-B7 cells. B, MCF10A-vec and MCF10-FB7 cells were fixed and stained for F-actin with Alexa Fluor 488-phalloidin. MDCK-vec and MDCK-B7 cells were fixed and processed for immunofluorescence with antibodies recognizing E-cadherin (2), claudin 7 (3), claudin 1 (4), claudin 4 (5), vimentin (6), and a-smooth muscle actin (green; 7). 6 and 7, the same cells were costained with Alexa Fluor 555-phalloidin (red) and vimentin or a-smooth muscle actin (green).

Journal: Cancer Research

Article Title: HOXB7, a Homeodomain Protein, Is Overexpressed in Breast Cancer and Confers Epithelial-Mesenchymal Transition

doi: 10.1158/0008-5472.can-05-4470

Figure Lengend Snippet: Figure 3. Cells with high expression of HOXB7 express mesenchymal markers and show loss of epithelial markers. A, Western blot analysis of E-cadherin, claudin 1 (CLD1), claudin 4 (CLD4), claudin 7 (CLD7), a-smooth muscle actin (a-SMA), and vimentin in MCF10A-vec, pooled clones of MCF10A-FB7 (MCF10A-FB7), and three separate clones (10A-FB7-C2, 10A-FB7-C5, and 10A-FB7-C10), MDCK-vec and pooled clones of MDCK-B7 cells. B, MCF10A-vec and MCF10-FB7 cells were fixed and stained for F-actin with Alexa Fluor 488-phalloidin. MDCK-vec and MDCK-B7 cells were fixed and processed for immunofluorescence with antibodies recognizing E-cadherin (2), claudin 7 (3), claudin 1 (4), claudin 4 (5), vimentin (6), and a-smooth muscle actin (green; 7). 6 and 7, the same cells were costained with Alexa Fluor 555-phalloidin (red) and vimentin or a-smooth muscle actin (green).

Article Snippet: Immortalized cell lines derived from normal human mammary epithelial cells, MCF10A, normal Madin-Darby canine kidney (MDCK) breast cancer cell lines (American Type Culture Collection, Manassas, VA), normal organoid, and tumor RNA were extracted by Trizol method, and all cDNAs were prepared with 1 Ag of RNA in SuperScript II (Invitrogen, Carlsbad, CA) reactions according to the instructions of the manufacturer.

Techniques: Expressing, Western Blot, Clone Assay, Staining, Immunofluorescence

β-adrenergic receptor expression on infantile hemangioma (IH) and normal endothelial cells. RT-PCR expression assays measuring the steady state levels of ADRB1, ADRB2, and ADRB3 mRNA in primary cultures of human infantile hemangioma endothelial cells (HemECs), human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells (HCAECs). Expression data are represented as the relative abundance of each transcript normalized to the GAPDH levels.

Journal: Experimental and Therapeutic Medicine

Article Title: Propranolol treatment of infantile hemangioma endothelial cells: A molecular analysis

doi: 10.3892/etm.2012.654

Figure Lengend Snippet: β-adrenergic receptor expression on infantile hemangioma (IH) and normal endothelial cells. RT-PCR expression assays measuring the steady state levels of ADRB1, ADRB2, and ADRB3 mRNA in primary cultures of human infantile hemangioma endothelial cells (HemECs), human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells (HCAECs). Expression data are represented as the relative abundance of each transcript normalized to the GAPDH levels.

Article Snippet: Primary cultures of neonatal human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells (HCAECs) were purchased from ATCC.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction

Propranolol decreases the proliferation of human infantile hemangioma endothelial cells (HemECs). (A) HemECs, human dermal microvascular endothelial cells (HDMVECs), and human coronary artery endothelial cells (HCAECs) were treated with a dose curve of propranolol (0 to 100 μM) and cell proliferation was measured by counting changes in the number of cells/defined vision field over a 48-h period. (B) Time lapse microscopy image of sham and 50 μM propranolol treated HemECs over a 48-h period. (C) DNA content analysis of propidium iodide stained HemECs treated with sham or 50 μM propranolol for 48 h. (D) Western blot analysis detecting the levels of phosphorylated and total vascular endothelial growth factor receptor-2 (p-VEGFR-2 and VEGFR-2, respectively) and the phosphorylated forms of p38 (p-p38), p44 (p-p44), p42 (p-p42), stress activated protein kinase (p-SAPK), c-jun N-terminal kinase (p-JNK), and activating transcription factor 4 (p-ATF4) in HemECs treated for 24 h with sham or 50 μM propranolol. Actin levels were used as a loading control. (E) Western blot analysis detecting the levels of cyclins, cyclin dependent kinases, and cyclin dependent kinase inhibitors in HemECs treated for 24 h with sham or 50 μM propranolol. Actin levels were used as a loading control. Prop, propranolol.

Journal: Experimental and Therapeutic Medicine

Article Title: Propranolol treatment of infantile hemangioma endothelial cells: A molecular analysis

doi: 10.3892/etm.2012.654

Figure Lengend Snippet: Propranolol decreases the proliferation of human infantile hemangioma endothelial cells (HemECs). (A) HemECs, human dermal microvascular endothelial cells (HDMVECs), and human coronary artery endothelial cells (HCAECs) were treated with a dose curve of propranolol (0 to 100 μM) and cell proliferation was measured by counting changes in the number of cells/defined vision field over a 48-h period. (B) Time lapse microscopy image of sham and 50 μM propranolol treated HemECs over a 48-h period. (C) DNA content analysis of propidium iodide stained HemECs treated with sham or 50 μM propranolol for 48 h. (D) Western blot analysis detecting the levels of phosphorylated and total vascular endothelial growth factor receptor-2 (p-VEGFR-2 and VEGFR-2, respectively) and the phosphorylated forms of p38 (p-p38), p44 (p-p44), p42 (p-p42), stress activated protein kinase (p-SAPK), c-jun N-terminal kinase (p-JNK), and activating transcription factor 4 (p-ATF4) in HemECs treated for 24 h with sham or 50 μM propranolol. Actin levels were used as a loading control. (E) Western blot analysis detecting the levels of cyclins, cyclin dependent kinases, and cyclin dependent kinase inhibitors in HemECs treated for 24 h with sham or 50 μM propranolol. Actin levels were used as a loading control. Prop, propranolol.

Article Snippet: Primary cultures of neonatal human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells (HCAECs) were purchased from ATCC.

Techniques: Time-lapse Microscopy, Staining, Western Blot, Control

Percentage of  endothelial  cells in each cell cycle phase.

Journal: Experimental and Therapeutic Medicine

Article Title: Propranolol treatment of infantile hemangioma endothelial cells: A molecular analysis

doi: 10.3892/etm.2012.654

Figure Lengend Snippet: Percentage of endothelial cells in each cell cycle phase.

Article Snippet: Primary cultures of neonatal human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells (HCAECs) were purchased from ATCC.

Techniques:

Propranolol does not induce apoptosis in human infantile hemangioma endothelial cells (HemECs) at its effective inhibitory concentration. (A) Confocal imaging of HemECs treated for 72 h with sham or 50 μM propranolol and subsequently co-stained with propidium iodide (PI) and Hoechst dye (blue, Hoechst-positive nuclei; pink, Hoechst-positive/PI-positive nuclei). (B) Quantification of PI-positive nuclei in HemECs, human dermal microvascular endothelial cells (HDMVECs), and human coronary artery endothelial cells (HCAECs) treated for 72 h with sham or 50 μM propranolol. (C) Western blot analysis detecting the levels of cleaved caspase-9 and -3 (cl-caspase-9 and cl-caspase -3, respectively). Actin levels were used as a loading control.

Journal: Experimental and Therapeutic Medicine

Article Title: Propranolol treatment of infantile hemangioma endothelial cells: A molecular analysis

doi: 10.3892/etm.2012.654

Figure Lengend Snippet: Propranolol does not induce apoptosis in human infantile hemangioma endothelial cells (HemECs) at its effective inhibitory concentration. (A) Confocal imaging of HemECs treated for 72 h with sham or 50 μM propranolol and subsequently co-stained with propidium iodide (PI) and Hoechst dye (blue, Hoechst-positive nuclei; pink, Hoechst-positive/PI-positive nuclei). (B) Quantification of PI-positive nuclei in HemECs, human dermal microvascular endothelial cells (HDMVECs), and human coronary artery endothelial cells (HCAECs) treated for 72 h with sham or 50 μM propranolol. (C) Western blot analysis detecting the levels of cleaved caspase-9 and -3 (cl-caspase-9 and cl-caspase -3, respectively). Actin levels were used as a loading control.

Article Snippet: Primary cultures of neonatal human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells (HCAECs) were purchased from ATCC.

Techniques: Concentration Assay, Imaging, Staining, Western Blot, Control

Propranolol disrupts HIHEC migration and actin cytoskeleton dynamics. (A) Confluent monolayers of human infantile hemangioma endothelial cells (HemECs) were scratch wounded and treated with sham or 50 μM propranolol. Progress of migration was monitored using time lapse photography over a period of 12 h. (B) Quantification of the speed (μm/h) of HemECs, human dermal microvascular endothelial cells (HDMVECs), and human coronary artery endothelial cells (HCAECs) treated with sham or propranolol from the time lapse images of the scratch assay. (C) Western blot analysis detecting the levels of the total and phophorylated (p-) forms of focal adhesion kinase (FAK), cofilin, ezrin/radixin/moesin (ERM), and myosin phosphatase-targeting subunit 1 (MYPT1) in HemECs treated with sham or 50 μM propranolol for 48 h. Actin levels were used as a loading control. (D) Confocal immunofluorescent imaging of sham or 50 μM propranolol-treated HemECs co-stained with Rhodamine conjugated phalloidin (red), DAPI (blue), and antibodies against phospho-FAK. Prop, propranolol.

Journal: Experimental and Therapeutic Medicine

Article Title: Propranolol treatment of infantile hemangioma endothelial cells: A molecular analysis

doi: 10.3892/etm.2012.654

Figure Lengend Snippet: Propranolol disrupts HIHEC migration and actin cytoskeleton dynamics. (A) Confluent monolayers of human infantile hemangioma endothelial cells (HemECs) were scratch wounded and treated with sham or 50 μM propranolol. Progress of migration was monitored using time lapse photography over a period of 12 h. (B) Quantification of the speed (μm/h) of HemECs, human dermal microvascular endothelial cells (HDMVECs), and human coronary artery endothelial cells (HCAECs) treated with sham or propranolol from the time lapse images of the scratch assay. (C) Western blot analysis detecting the levels of the total and phophorylated (p-) forms of focal adhesion kinase (FAK), cofilin, ezrin/radixin/moesin (ERM), and myosin phosphatase-targeting subunit 1 (MYPT1) in HemECs treated with sham or 50 μM propranolol for 48 h. Actin levels were used as a loading control. (D) Confocal immunofluorescent imaging of sham or 50 μM propranolol-treated HemECs co-stained with Rhodamine conjugated phalloidin (red), DAPI (blue), and antibodies against phospho-FAK. Prop, propranolol.

Article Snippet: Primary cultures of neonatal human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells (HCAECs) were purchased from ATCC.

Techniques: Migration, Wound Healing Assay, Western Blot, Control, Imaging, Staining

Propranolol induces significant alterations in global gene expression of human infantile hemangioma endothelial cells (HemECs). (A) Correlation map comparing the significant gene expression changes (>2 fold gene expression alteration, p<0.05) as determined by microarray analysis between HemECs, human dermal microvascular endothelial cells (HDMVECs), and human coronary artery endothelial cells (HCAECs) treated with sham or 50 μM propranolol for 24 h. (B) RT-PCR confirmation of a subset of genes in HemECs whose expression was statistically altered in the microarray.

Journal: Experimental and Therapeutic Medicine

Article Title: Propranolol treatment of infantile hemangioma endothelial cells: A molecular analysis

doi: 10.3892/etm.2012.654

Figure Lengend Snippet: Propranolol induces significant alterations in global gene expression of human infantile hemangioma endothelial cells (HemECs). (A) Correlation map comparing the significant gene expression changes (>2 fold gene expression alteration, p<0.05) as determined by microarray analysis between HemECs, human dermal microvascular endothelial cells (HDMVECs), and human coronary artery endothelial cells (HCAECs) treated with sham or 50 μM propranolol for 24 h. (B) RT-PCR confirmation of a subset of genes in HemECs whose expression was statistically altered in the microarray.

Article Snippet: Primary cultures of neonatal human dermal microvascular endothelial cells (HDMVECs) and human coronary artery endothelial cells (HCAECs) were purchased from ATCC.

Techniques: Gene Expression, Microarray, Reverse Transcription Polymerase Chain Reaction, Expressing

Summary of gene expression profiling studies involving human COPD/emphysema samples

Journal: International Journal of Chronic Obstructive Pulmonary Disease

Article Title: Identifying targets for COPD treatment through gene expression analyses

doi:

Figure Lengend Snippet: Summary of gene expression profiling studies involving human COPD/emphysema samples

Article Snippet: COPD GOLD2 vs. GOLD0 , Whole lung , Incyte Unigem high-density microarray (10,000 transcripts) SAGE (59,000 tags) , Apoptosis-related genes Inflammation-related genes Transcription factors (increased) Collagens (decreased) , Egr-1/Fos CTGF, CYR61, CX3CL1, TGFB1, and PDGFRA , .

Techniques: Expressing, Functional Assay, Microarray

Real-time RT-PCR amplification conditions for each primer pair

Journal: Reproductive biology and endocrinology : RB&E

Article Title: Uterine extracellular matrix components are altered during defective decidualization in interleukin-11 receptor α deficient mice

doi: 10.1186/1477-7827-2-76

Figure Lengend Snippet: Real-time RT-PCR amplification conditions for each primer pair

Article Snippet: Primary antibodies used were rabbit anti-mouse collagen type III (Abcam #ab7778, Cambridge, UK) at 5 μg/ml, rabbit anti-mouse biglycan (LF-159 [ ], gift from Dr. Larry Fisher, Matrix Biochemistry Unit, National Institutes of Health, Bethesda, MD) at 1:1000 dilution of whole serum, goat anti-mouse SPARC (Santa Cruz Biotechnology #sc13326, Santa Cruz, CA) at 5 μg/ml, rat anti-mouse entactin/nidogen-1 (Lab Vision-NeoMarkers #RT797P, Fremont, CA) at 15 μg/ml and goat anti-mouse desmin (Santa Cruz) at 200 μg/ml.

Techniques: Quantitative RT-PCR, Amplification

Oligonucleotide primers used in real-time RT-PCR. Primer pairs previously published – COL3A1 [82], BGN [83],  SPARC  [84] and NID1 [85].

Journal: Reproductive biology and endocrinology : RB&E

Article Title: Uterine extracellular matrix components are altered during defective decidualization in interleukin-11 receptor α deficient mice

doi: 10.1186/1477-7827-2-76

Figure Lengend Snippet: Oligonucleotide primers used in real-time RT-PCR. Primer pairs previously published – COL3A1 [82], BGN [83], SPARC [84] and NID1 [85].

Article Snippet: Primary antibodies used were rabbit anti-mouse collagen type III (Abcam #ab7778, Cambridge, UK) at 5 μg/ml, rabbit anti-mouse biglycan (LF-159 [ ], gift from Dr. Larry Fisher, Matrix Biochemistry Unit, National Institutes of Health, Bethesda, MD) at 1:1000 dilution of whole serum, goat anti-mouse SPARC (Santa Cruz Biotechnology #sc13326, Santa Cruz, CA) at 5 μg/ml, rat anti-mouse entactin/nidogen-1 (Lab Vision-NeoMarkers #RT797P, Fremont, CA) at 15 μg/ml and goat anti-mouse desmin (Santa Cruz) at 200 μg/ml.

Techniques: Quantitative RT-PCR

Gene expression in IL11Ra +/+ and IL11Ra -/- uterus following artificial decidualization. Expression profiling of 15K genes between IL11Ra +/+ and IL11Ra -/- at 0 h (A, B), 18 h (C, D), 24 h (E, F) and 48 h (G, H) following the artificial induction of decidualization. Each volcano style plot shows the normalized log ratio (effect estimate) of IL11Ra -/- compared to wild type for each gene from a series of 4 microarrays, plotted against the log odds of differential expression. A, C, E, G represent the first replicates, and B, D, F, H the second dye-swapped replicates. Genes with log odds of differential expression greater than 3 (ie. adjusted p -value < 0.05, above horizontal line) are represented by open circles, and COL3A1, BGN, SPARC and NID1 are labeled in G and H. Only those genes with log odds of differential expression greater than 3 in both replicates were considered differentially expressed, as described in Methods .

Journal: Reproductive biology and endocrinology : RB&E

Article Title: Uterine extracellular matrix components are altered during defective decidualization in interleukin-11 receptor α deficient mice

doi: 10.1186/1477-7827-2-76

Figure Lengend Snippet: Gene expression in IL11Ra +/+ and IL11Ra -/- uterus following artificial decidualization. Expression profiling of 15K genes between IL11Ra +/+ and IL11Ra -/- at 0 h (A, B), 18 h (C, D), 24 h (E, F) and 48 h (G, H) following the artificial induction of decidualization. Each volcano style plot shows the normalized log ratio (effect estimate) of IL11Ra -/- compared to wild type for each gene from a series of 4 microarrays, plotted against the log odds of differential expression. A, C, E, G represent the first replicates, and B, D, F, H the second dye-swapped replicates. Genes with log odds of differential expression greater than 3 (ie. adjusted p -value < 0.05, above horizontal line) are represented by open circles, and COL3A1, BGN, SPARC and NID1 are labeled in G and H. Only those genes with log odds of differential expression greater than 3 in both replicates were considered differentially expressed, as described in Methods .

Article Snippet: Primary antibodies used were rabbit anti-mouse collagen type III (Abcam #ab7778, Cambridge, UK) at 5 μg/ml, rabbit anti-mouse biglycan (LF-159 [ ], gift from Dr. Larry Fisher, Matrix Biochemistry Unit, National Institutes of Health, Bethesda, MD) at 1:1000 dilution of whole serum, goat anti-mouse SPARC (Santa Cruz Biotechnology #sc13326, Santa Cruz, CA) at 5 μg/ml, rat anti-mouse entactin/nidogen-1 (Lab Vision-NeoMarkers #RT797P, Fremont, CA) at 15 μg/ml and goat anti-mouse desmin (Santa Cruz) at 200 μg/ml.

Techniques: Gene Expression, Expressing, Quantitative Proteomics, Labeling

Differentially expressed genes in IL11Ra -/- uterus compared to wild type at 48 h of decidualization

Journal: Reproductive biology and endocrinology : RB&E

Article Title: Uterine extracellular matrix components are altered during defective decidualization in interleukin-11 receptor α deficient mice

doi: 10.1186/1477-7827-2-76

Figure Lengend Snippet: Differentially expressed genes in IL11Ra -/- uterus compared to wild type at 48 h of decidualization

Article Snippet: Primary antibodies used were rabbit anti-mouse collagen type III (Abcam #ab7778, Cambridge, UK) at 5 μg/ml, rabbit anti-mouse biglycan (LF-159 [ ], gift from Dr. Larry Fisher, Matrix Biochemistry Unit, National Institutes of Health, Bethesda, MD) at 1:1000 dilution of whole serum, goat anti-mouse SPARC (Santa Cruz Biotechnology #sc13326, Santa Cruz, CA) at 5 μg/ml, rat anti-mouse entactin/nidogen-1 (Lab Vision-NeoMarkers #RT797P, Fremont, CA) at 15 μg/ml and goat anti-mouse desmin (Santa Cruz) at 200 μg/ml.

Techniques: Clinical Proteomics, Sequencing, Reverse Transcription

Quantitative real-time RT-PCR for extracellular matrix components. Quantitative real-time RT-PCR for (A) COL3A1, (B) BGN, (C) SPARC and (D) NID1. Circled data points indicate samples used in the cDNA microarray analysis, and horizontal lines the mean of each genotype. Absolute values for mRNA abundance were normalized to that of 18S rRNA.

Journal: Reproductive biology and endocrinology : RB&E

Article Title: Uterine extracellular matrix components are altered during defective decidualization in interleukin-11 receptor α deficient mice

doi: 10.1186/1477-7827-2-76

Figure Lengend Snippet: Quantitative real-time RT-PCR for extracellular matrix components. Quantitative real-time RT-PCR for (A) COL3A1, (B) BGN, (C) SPARC and (D) NID1. Circled data points indicate samples used in the cDNA microarray analysis, and horizontal lines the mean of each genotype. Absolute values for mRNA abundance were normalized to that of 18S rRNA.

Article Snippet: Primary antibodies used were rabbit anti-mouse collagen type III (Abcam #ab7778, Cambridge, UK) at 5 μg/ml, rabbit anti-mouse biglycan (LF-159 [ ], gift from Dr. Larry Fisher, Matrix Biochemistry Unit, National Institutes of Health, Bethesda, MD) at 1:1000 dilution of whole serum, goat anti-mouse SPARC (Santa Cruz Biotechnology #sc13326, Santa Cruz, CA) at 5 μg/ml, rat anti-mouse entactin/nidogen-1 (Lab Vision-NeoMarkers #RT797P, Fremont, CA) at 15 μg/ml and goat anti-mouse desmin (Santa Cruz) at 200 μg/ml.

Techniques: Quantitative RT-PCR, Microarray

Immunohistochemistry for extracellular matrix components. Immunohistochemical staining of wild type (A, C, E, G, I, K, M, O, P, Q, S) and IL11Ra -/- (B, D, F, H, J, L, N, R, T) uterus at 48 h of decidualization using specific antibodies for collagen III (A, B, C, D), biglycan (E, F, G, H), nidogen-1 (I, J, K, L), SPARC (M, N, O, P) and desmin (Q, R, S, T). Negative controls using a matching concentration of non-immune IgG (collagen III, nidogen-1, SPARC and desmin) or normal serum (biglycan) in place of the primary antibody are inset in A, B, E, F, I, J, M, N, Q and R. Black squares on A and B indicate the antimesometrial pole magnified in C and D. Abbreviations: connective tissue (ct), myometrium (my), mesometrial pole (m), antimesometrial pole (am), luminal epithelium (le), glandular epithelium (ge), decidualized stromal cell (dsc), non-decidualized stromal cell (sc), blood vessel (bv), glycocalyx (gly). Scale bar = 50 μm (A, B, E, F, I, J, M, N, Q and R are at the same magnification; C, D, G and P are at the same magnification; H, K, L, O, S, T and inset in G are at the same magnification).

Journal: Reproductive biology and endocrinology : RB&E

Article Title: Uterine extracellular matrix components are altered during defective decidualization in interleukin-11 receptor α deficient mice

doi: 10.1186/1477-7827-2-76

Figure Lengend Snippet: Immunohistochemistry for extracellular matrix components. Immunohistochemical staining of wild type (A, C, E, G, I, K, M, O, P, Q, S) and IL11Ra -/- (B, D, F, H, J, L, N, R, T) uterus at 48 h of decidualization using specific antibodies for collagen III (A, B, C, D), biglycan (E, F, G, H), nidogen-1 (I, J, K, L), SPARC (M, N, O, P) and desmin (Q, R, S, T). Negative controls using a matching concentration of non-immune IgG (collagen III, nidogen-1, SPARC and desmin) or normal serum (biglycan) in place of the primary antibody are inset in A, B, E, F, I, J, M, N, Q and R. Black squares on A and B indicate the antimesometrial pole magnified in C and D. Abbreviations: connective tissue (ct), myometrium (my), mesometrial pole (m), antimesometrial pole (am), luminal epithelium (le), glandular epithelium (ge), decidualized stromal cell (dsc), non-decidualized stromal cell (sc), blood vessel (bv), glycocalyx (gly). Scale bar = 50 μm (A, B, E, F, I, J, M, N, Q and R are at the same magnification; C, D, G and P are at the same magnification; H, K, L, O, S, T and inset in G are at the same magnification).

Article Snippet: Primary antibodies used were rabbit anti-mouse collagen type III (Abcam #ab7778, Cambridge, UK) at 5 μg/ml, rabbit anti-mouse biglycan (LF-159 [ ], gift from Dr. Larry Fisher, Matrix Biochemistry Unit, National Institutes of Health, Bethesda, MD) at 1:1000 dilution of whole serum, goat anti-mouse SPARC (Santa Cruz Biotechnology #sc13326, Santa Cruz, CA) at 5 μg/ml, rat anti-mouse entactin/nidogen-1 (Lab Vision-NeoMarkers #RT797P, Fremont, CA) at 15 μg/ml and goat anti-mouse desmin (Santa Cruz) at 200 μg/ml.

Techniques: Immunohistochemistry, Immunohistochemical staining, Staining, Concentration Assay

mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was Cy3-labeled cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.

Journal:

Article Title: Brain Lipid Binding Protein in Axon-Schwann Cell Interactions and Peripheral Nerve Tumorigenesis

doi: 10.1128/MCB.23.6.2213-2224.2003

Figure Lengend Snippet: mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was Cy3-labeled cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.

Article Snippet: Expression of exogenous protein was detected by immunolabeling with mouse anti-HA (Santa Cruz) followed by donkey anti-mouse Cy3-conjugated secondary antibodies (Jackson Immunoresearch) or goat anti-human EGFR antibodies (Santa Cruz) followed by donkey anti-goat tetramethyl rhodamine isocyanate-labeled secondary antibodies (Jackson Immunoresearch).

Techniques: Expressing, Mutagenesis, Microarray, Genome Wide, Labeling, Generated, Sequencing, Software, Reverse Transcription Polymerase Chain Reaction, Amplification, Plasmid Preparation, Positive Control, Real-time Polymerase Chain Reaction, Over Expression

Mouse neuron-Schwann cell coculture. Anti-BLBP promotes extension of Nf1−/− TXF cell processes along axons. Wild-type (A and B) or Nf1−/− TXF (C and D) mouse Schwann cells labeled with Cell Tracker green were preincubated with rabbit IgG (A and C) or anti-BLBP antibodies (B and D) and seeded onto DRGN cultures stripped of endogenous Schwann cells. Two days after seeding, cocultures were fixed and stained with antineurofilament antibodies followed by Cy3 (red)-conjugated secondary antibodies. Confocal images obtained with Zeiss LSM Image Browser software are shown. Single cells are representative of the majority observed with each treatment. Arrowheads indicate Schwann cell processes. The asterisk indicates the region which is magnified fivefold in the inset. The scale bar in panel C equals 5 μm and also applies to panels A, B, and D. (E) Lower magnification (scale bar, 5 μm) of Nf1−/− TXF on DRGN cultures in the presence of anti-BLBP antibodies. Arrowheads indicate processes from two cells extending along neurites; other cells lack processes. (F) Extension of Nf1−/− TXF cell processes in the presence of anti-BLBP antibodies is statistically significant. The percentages of Nf1−/− TXF cells extending processes along axons in the presence of control IgG (gray bar) or anti-BLBP antibodies (black bar) are graphed. Error bars reflect standard deviations in a Student t test (P = 0.003).

Journal:

Article Title: Brain Lipid Binding Protein in Axon-Schwann Cell Interactions and Peripheral Nerve Tumorigenesis

doi: 10.1128/MCB.23.6.2213-2224.2003

Figure Lengend Snippet: Mouse neuron-Schwann cell coculture. Anti-BLBP promotes extension of Nf1−/− TXF cell processes along axons. Wild-type (A and B) or Nf1−/− TXF (C and D) mouse Schwann cells labeled with Cell Tracker green were preincubated with rabbit IgG (A and C) or anti-BLBP antibodies (B and D) and seeded onto DRGN cultures stripped of endogenous Schwann cells. Two days after seeding, cocultures were fixed and stained with antineurofilament antibodies followed by Cy3 (red)-conjugated secondary antibodies. Confocal images obtained with Zeiss LSM Image Browser software are shown. Single cells are representative of the majority observed with each treatment. Arrowheads indicate Schwann cell processes. The asterisk indicates the region which is magnified fivefold in the inset. The scale bar in panel C equals 5 μm and also applies to panels A, B, and D. (E) Lower magnification (scale bar, 5 μm) of Nf1−/− TXF on DRGN cultures in the presence of anti-BLBP antibodies. Arrowheads indicate processes from two cells extending along neurites; other cells lack processes. (F) Extension of Nf1−/− TXF cell processes in the presence of anti-BLBP antibodies is statistically significant. The percentages of Nf1−/− TXF cells extending processes along axons in the presence of control IgG (gray bar) or anti-BLBP antibodies (black bar) are graphed. Error bars reflect standard deviations in a Student t test (P = 0.003).

Article Snippet: Expression of exogenous protein was detected by immunolabeling with mouse anti-HA (Santa Cruz) followed by donkey anti-mouse Cy3-conjugated secondary antibodies (Jackson Immunoresearch) or goat anti-human EGFR antibodies (Santa Cruz) followed by donkey anti-goat tetramethyl rhodamine isocyanate-labeled secondary antibodies (Jackson Immunoresearch).

Techniques: Labeling, Staining, Software

Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Article Snippet: Normalization , UBC (Hs00824723_ml) , ΔCt(target gene) = Ct(target gene) - √(Ct(ITFG1) × Ct(DPM1)) ITFG1 (Hs00229263_ml), DPM1 (Hs00187270_ml) , MRPS5-F: TAAACGGGAGCGAGGATGGA; MRPS5-R: ATGTTTCTCCACAGGGACCAG , Human 18S rRNA (sequence, forward: GCTTAATTTGACTCAACACGGGA, reverse: AGCTATCAATCTGTCAATCCTGTCC, Thermo Fisher Scientific) , TaqMan assay: ITFG1; SYBR Green assay: GAPDH and HPRT geometric mean , HPRT1 , Human 18S rRNA (Hs99999901_g1, Thermo Fisher Scientific) , set normalization algorithm , Software (v.9.5.1) Processed signal value were log2-transformed, normalization via GAPDH.

Techniques: Generated

Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Normalization , UBC (Hs00824723_ml) , ΔCt(target gene) = Ct(target gene) - √(Ct(ITFG1) × Ct(DPM1)) ITFG1 (Hs00229263_ml), DPM1 (Hs00187270_ml) , MRPS5-F: TAAACGGGAGCGAGGATGGA; MRPS5-R: ATGTTTCTCCACAGGGACCAG , Human 18S rRNA (sequence, forward: GCTTAATTTGACTCAACACGGGA, reverse: AGCTATCAATCTGTCAATCCTGTCC, Thermo Fisher Scientific) , TaqMan assay: ITFG1; SYBR Green assay: GAPDH and HPRT geometric mean , HPRT1 , Human 18S rRNA (Hs99999901_g1, Thermo Fisher Scientific) , set normalization algorithm , Software (v.9.5.1) Processed signal value were log2-transformed, normalization via GAPDH.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction